Skip to main content
Addgene

XLone-Puro Cas13d-eGFP U6 BbsI
(Plasmid #155184)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155184 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Addgene #155182
  • Backbone size (bp) 9512
  • Vector type
    Mammalian Expression, Unspecified ; Piggybac transposon
  • Promoter U6
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
  • 3′ sequencing primer M13 RVS
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The T2A-Puro sequence was re-amplified and cloned into the backbone to remove BbsI restriction site in the T2A sequence. To clone Cas13d gRNA for gene knockdown, digest the plasmid with BbsI and then ligate annealed oligo into the backbone. gRNA could be designed using https://cas13design.nygenome.org/ and annealing oligoes should have the following format, where Ns and Ms are the gRNA sequence and its reverse-complement counterpart:
FWD:5'- AAACNNNNNNNNNNNNN
RVS: 5'-AAAAMMMMMMMMMMM

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-Puro Cas13d-eGFP U6 BbsI was a gift from Xiaoping Bao (Addgene plasmid # 155184 ; http://n2t.net/addgene:155184 ; RRID:Addgene_155184)

  • For your References section:

    Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999
Related items:
Commonly requested with: