pET303-colE1T
(Plasmid
#155180)
-
PurposeExpresses colicin E1 residues 1-190
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET303
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5343
- Total vector size (bp) 5937
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecolicin E1 residues 1-190
-
SpeciesE. coli
-
Insert Size (bp)594
-
Mutationtruncation of colicin E1 including 1-190
-
GenBank IDAAA59418.1
- Promoter T7
-
Tag
/ Fusion Protein
- C-terminal 6x Histidine tag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/692251 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET303-colE1T was a gift from Joanna Slusky (Addgene plasmid # 155180 ; http://n2t.net/addgene:155180 ; RRID:Addgene_155180) -
For your References section:
Colicin E1 opens its hinge to plug TolC. Budiardjo SJ, Stevens JJ, Calkins AL, Ikujuni AP, Wimalasena VK, Firlar E, Case DA, Biteen JS, Kaelber JT, Slusky JSG. Elife. 2022 Feb 24;11. pii: 73297. doi: 10.7554/eLife.73297. 10.7554/eLife.73297 PubMed 35199644