HDM-SARS2-Spike-delta21
(Plasmid #155130)

• Purpose: Encodes SARS-CoV-2 Spike with 21 aa C-terminal deletions for lentiviral pseudotyping
• Depositing Lab: Jesse Bloom
• Publication: Crawford et al Viruses. 2020 May 6;12(5). pii: v12050513. doi: 10.3390/v12050513.

Backbone

• Vector backbone: HDM
• Backbone size w/o insert (bp): 4750
• Total vector size (bp): 8314
• Modifications to backbone: CGCCACC added 3' to EcoRI site and 5' to S start codon
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV-2 Spike-delta21
• Alt name: Codon optimized SARS-CoV-2 Spike
• Species: Severe acute respiratory syndrome coronavirus 2
• Insert Size (bp): 3762
• Mutation: Codon optimized to H. sapiens using IDT codon optimization tool; deleted 21 amino acids by deletion from 3769-3831
• GenBank ID: 43740568
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CGCATGGTGTGGTCTTTCTCC
• 3′ sequencing primer: agtccaagctaggcccttttg

Resource Information

• Supplemental Documents:
  • 2777_HDM-SARS2-Spike-delta21.gb
• Articles Citing this Plasmid:
  • 12 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Based on a plasmid described previously in Crawford et al. 2020, Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays (https://www.mdpi.com/1999-4915/12/5/513) This is a version of the Spike expression plasmid used to pseudotype lentivirus which provided better titers in this protocol.