Addgene: pTol2CG2-ubi:QFGal4-SV40pA Skip to main content
Addgene

pTol2CG2-ubi:QFGal4-SV40pA
(Plasmid #155119)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155119 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDestTol2CG2 (Tol2 kit 1.0 #395)
  • Backbone manufacturer
    Esther Fujimoto, Chien lab
  • Backbone size w/o insert (bp) 6251
  • Total vector size (bp) 11237
  • Modifications to backbone
    cmlc2:GFP replaced with cmlc2:membrane-mRFP in reverse orientation
  • Vector type
    Zebrafish expression
  • Selectable markers
    cmlc2:mRFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ubi:QFGal4
  • Species
    D. rerio (zebrafish), S. cerevisiae (budding yeast); Neurospora crassa
  • Insert Size (bp)
    4986
  • GenBank ID
    855828 3875756
  • Entrez Gene
    ubb (a.k.a. Ubi-p63E, im:6892314, si:ch211-202a12.3, ubc, zUBC, zgc:172187)
  • Promoter ubiquitin B

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gctgcaaatagcaggaaacg
  • 3′ sequencing primer GAGGATCATAATCAGCCATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2CG2-ubi:QFGal4-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155119 ; http://n2t.net/addgene:155119 ; RRID:Addgene_155119)
  • For your References section:

    An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972