pLX304_C12orf49-V5
(Plasmid
#155110)
-
Purposelentiviral plasmid for the exogneous expression of C-terminal V5-tagged C12orf49
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLX304 (Addgene plasmid #25890)
- Backbone size w/o insert (bp) 7720
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC12orf49
-
SpeciesH. sapiens (human)
-
Insert Size (bp)617
-
Entrez GeneSPRING1 (a.k.a. C12orf49, LUR1, POST1, SPRING)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhORF 9.1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX304_C12orf49-V5 was a gift from Jason Moffat (Addgene plasmid # 155110 ; http://n2t.net/addgene:155110 ; RRID:Addgene_155110) -
For your References section:
Systematic mapping of genetic interactions for de novo fatty acid synthesis identifies C12orf49 as a regulator of lipid metabolism. Aregger M, Lawson KA, Billmann M, Costanzo M, Tong AHY, Chan K, Rahman M, Brown KR, Ross C, Usaj M, Nedyalkova L, Sizova O, Habsid A, Pawling J, Lin ZY, Abdouni H, Wong CJ, Weiss A, Mero P, Dennis JW, Gingras AC, Myers CL, Andrews BJ, Boone C, Moffat J. Nat Metab. 2020 Jun;2(6):499-513. doi: 10.1038/s42255-020-0211-z. Epub 2020 Jun 1. 10.1038/s42255-020-0211-z PubMed 32694731