Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LCV2_mCherry_Luciferase_sgRNA
(Plasmid #155109)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155109 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LCV2_mCherry
  • Backbone size w/o insert (bp) 14744
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luciferase_sgRNA
  • gRNA/shRNA sequence
    ACAACTTTACCGACCGCGCC
  • Species
    Other
  • Insert Size (bp)
    20
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI/Esp3I (destroyed during cloning)
  • 3′ cloning site BsmBI/Esp3I (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LCV2_mCherry_Luciferase_sgRNA was a gift from Jason Moffat (Addgene plasmid # 155109 ; http://n2t.net/addgene:155109 ; RRID:Addgene_155109)
  • For your References section:

    Systematic mapping of genetic interactions for de novo fatty acid synthesis identifies C12orf49 as a regulator of lipid metabolism. Aregger M, Lawson KA, Billmann M, Costanzo M, Tong AHY, Chan K, Rahman M, Brown KR, Ross C, Usaj M, Nedyalkova L, Sizova O, Habsid A, Pawling J, Lin ZY, Abdouni H, Wong CJ, Weiss A, Mero P, Dennis JW, Gingras AC, Myers CL, Andrews BJ, Boone C, Moffat J. Nat Metab. 2020 Jun;2(6):499-513. doi: 10.1038/s42255-020-0211-z. Epub 2020 Jun 1. 10.1038/s42255-020-0211-z PubMed 32694731