LCV2_mClover3_LacZ
(Plasmid
#155103)
-
Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZ
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLCV2_mClover3
- Backbone size w/o insert (bp) 14753
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacZ_sgRNA_2
-
gRNA/shRNA sequenceCCCGAATCTCTATCGTGCGG
-
SpeciesOther
-
Insert Size (bp)20
- Promoter U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI/Esp3I (destroyed during cloning)
- 3′ cloning site BsmBI/Esp3I (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LCV2_mClover3_LacZ was a gift from Jason Moffat (Addgene plasmid # 155103 ; http://n2t.net/addgene:155103 ; RRID:Addgene_155103) -
For your References section:
Systematic mapping of genetic interactions for de novo fatty acid synthesis identifies C12orf49 as a regulator of lipid metabolism. Aregger M, Lawson KA, Billmann M, Costanzo M, Tong AHY, Chan K, Rahman M, Brown KR, Ross C, Usaj M, Nedyalkova L, Sizova O, Habsid A, Pawling J, Lin ZY, Abdouni H, Wong CJ, Weiss A, Mero P, Dennis JW, Gingras AC, Myers CL, Andrews BJ, Boone C, Moffat J. Nat Metab. 2020 Jun;2(6):499-513. doi: 10.1038/s42255-020-0211-z. Epub 2020 Jun 1. 10.1038/s42255-020-0211-z PubMed 32694731