Skip to main content
Addgene

LCV2_PSMD1_sgRNA_1
(Plasmid #155091)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155091 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPRv2 (LCV2) (Addgene plasmid #52961)
  • Backbone size w/o insert (bp) 13970
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PSMD1_sgRNA_1
  • gRNA/shRNA sequence
    TGTGCGCTACGGAGCTGCAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    PSMD1 (a.k.a. P112, Rpn2, S1)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI/Esp3I (destroyed during cloning)
  • 3′ cloning site BsmBI/Esp3I (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LCV2_PSMD1_sgRNA_1 was a gift from Jason Moffat (Addgene plasmid # 155091 ; http://n2t.net/addgene:155091 ; RRID:Addgene_155091)
  • For your References section:

    Systematic mapping of genetic interactions for de novo fatty acid synthesis identifies C12orf49 as a regulator of lipid metabolism. Aregger M, Lawson KA, Billmann M, Costanzo M, Tong AHY, Chan K, Rahman M, Brown KR, Ross C, Usaj M, Nedyalkova L, Sizova O, Habsid A, Pawling J, Lin ZY, Abdouni H, Wong CJ, Weiss A, Mero P, Dennis JW, Gingras AC, Myers CL, Andrews BJ, Boone C, Moffat J. Nat Metab. 2020 Jun;2(6):499-513. doi: 10.1038/s42255-020-0211-z. Epub 2020 Jun 1. 10.1038/s42255-020-0211-z PubMed 32694731