Skip to main content
Addgene

plenti-As-Cas12a-2xNLS
(Plasmid #155047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155047 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lenti CRISPR pXPR_001/Lenti_Cas9_2A_Blast (Addgene plasmid #73310)
  • Backbone size w/o insert (bp) 7368
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AsCas12a
  • Species
    Acidaminococcus sp. BV3L6
  • Insert Size (bp)
    4065
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • Nucleoplasmin NLS, Myc-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GGGTGGGGGAGAACCGTATA
  • 3′ sequencing primer TGGGCCAGGATTCTCCTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The NeoR/KanR cassette contains S177R and E182D mismatches compared to the reference sequence. The depositing lab does not believe these are of functional concern but the construct should be functionally validated prior to experimentation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plenti-As-Cas12a-2xNLS was a gift from Benjamin Blencowe & Jason Moffat (Addgene plasmid # 155047 ; http://n2t.net/addgene:155047 ; RRID:Addgene_155047)
  • For your References section:

    Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Gonatopoulos-Pournatzis T, Aregger M, Brown KR, Farhangmehr S, Braunschweig U, Ward HN, Ha KCH, Weiss A, Billmann M, Durbic T, Myers CL, Blencowe BJ, Moffat J. Nat Biotechnol. 2020 May;38(5):638-648. doi: 10.1038/s41587-020-0437-z. Epub 2020 Mar 16. 10.1038/s41587-020-0437-z PubMed 32249828