plenti-As-Cas12a-2xNLS
(Plasmid #155047)

• Purpose: Lentiviral vector expressing human codon-optimized _C-terminal Myc-tagged _Acidaminococcus sp. BV3L6 (As)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoter
• Depositing Labs: Benjamin Blencowe, Jason Moffat
• Publication: Gonatopoulos-Pournatzis et al Nat Biotechnol. 2020 May;38(5):638-648. doi: 10.1038/s41587-020-0437-z. Epub 2020 Mar 16.

Backbone

• Vector backbone: lenti CRISPR pXPR_001/Lenti_Cas9_2A_Blast (Addgene plasmid #73310)
• Backbone size w/o insert (bp): 7368
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AsCas12a
• Species: Acidaminococcus sp. BV3L6
• Insert Size (bp): 4065
• Promoter: EF-1a
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • Nucleoplasmin NLS, Myc-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: GGGTGGGGGAGAACCGTATA
• 3′ sequencing primer: TGGGCCAGGATTCTCCTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The NeoR/KanR cassette contains S177R and E182D mismatches compared to the reference sequence. The depositing lab does not believe these are of functional concern but the construct should be functionally validated prior to experimentation.