-
PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV5 | 154951-AAV5 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 | ||
AAV9 | 154951-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 | ||
AAV Retrograde | 154951-AAVrg | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 |
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 4822
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesomBiPOLES
-
SpeciesSynthetic
-
Insert Size (bp)3273
- Promoter human synapsin
-
Tag
/ Fusion Protein
- soma-targeting motif from Kv2.1 channel (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer TGTTGCTCCTTTTACGCTATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2) . Please visit https://www.biorxiv.org/content/10.1101/2020.07.15.204347v1 for bioRxiv preprint.
Information for AAV5 (Catalog # 154951-AAV5) ( Back to top)
Purpose
Ready-to-use AAV5 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA.
Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCerulean (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Information for AAV9 (Catalog # 154951-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA.
Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCerulean (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Information for AAV Retrograde (Catalog # 154951-AAVrg) ( Back to top)
Purpose
Ready-to-use AAV Retrograde particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA.
Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV retrograde (AAVrg)
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCerulean (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSyn-DIO-somBiPOLES-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 154951 ; http://n2t.net/addgene:154951 ; RRID:Addgene_154951) For viral preps, please replace (Addgene plasmid # 154951) in the above sentence with: (Addgene viral prep # 154951-AAV5), (Addgene viral prep # 154951-AAV9), or (Addgene viral prep # 154951-AAVrg) -
For your References section:
BiPOLES is an optogenetic tool developed for bidirectional dual-color control of neurons. Vierock J, Rodriguez-Rozada S, Dieter A, Pieper F, Sims R, Tenedini F, Bergs ACF, Bendifallah I, Zhou F, Zeitzschel N, Ahlbeck J, Augustin S, Sauter K, Papagiakoumou E, Gottschalk A, Soba P, Emiliani V, Engel AK, Hegemann P, Wiegert JS. Nat Commun. 2021 Jul 26;12(1):4527. doi: 10.1038/s41467-021-24759-5. 10.1038/s41467-021-24759-5 PubMed 34312384