Skip to main content
Addgene

mDlx-somBiPOLES-mCerulean
(Plasmid #154947)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154947 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 4758
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    somBiPOLES
  • Species
    Synthetic
  • Insert Size (bp)
    3273
  • Promoter minimal Dlx
  • Tag / Fusion Protein
    • soma-targeting motif from Kv2.1 channel (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer TTGCCTTTCTCTCCACAGGT
  • 3′ sequencing primer TGTTGCTCCTTTTACGCTATG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2) . Please visit https://www.biorxiv.org/content/10.1101/2020.07.15.204347v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mDlx-somBiPOLES-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 154947)

  • For your References section:

    BiPOLES is an optogenetic tool developed for bidirectional dual-color control of neurons. Vierock J, Rodriguez-Rozada S, Dieter A, Pieper F, Sims R, Tenedini F, Bergs ACF, Bendifallah I, Zhou F, Zeitzschel N, Ahlbeck J, Augustin S, Sauter K, Papagiakoumou E, Gottschalk A, Soba P, Emiliani V, Engel AK, Hegemann P, Wiegert JS. Nat Commun. 2021 Jul 26;12(1):4527. doi: 10.1038/s41467-021-24759-5. 10.1038/s41467-021-24759-5 PubMed 34312384
Related items: