hSyn-somBiPOLES-mCerulean
(Plasmid #154945)

• Purpose: Optogenetic tool for blue-light inhibition and red-light excitation of neurons
• Depositing Lab: Simon Wiegert
• Publication: Vierock et al Nat Commun. 2021 Jul 26;12(1):4527. doi: 10.1038/s41467-021-24759-5.

Backbone

• Vector backbone: pAAV2
• Backbone size w/o insert (bp): 4359
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: somBiPOLES
• Species: Synthetic
• Insert Size (bp): 3273
• Promoter: human synapsin
• Tag / Fusion Protein:
  • soma-targeting motif from Kv2.1 channel (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: TGTTGCTCCTTTTACGCTATG

Resource Information

• Supplemental Documents:
  • hSyn-somBiPOLES-mCerulean.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2). Please note that the Addgene verified sequence identified differences in the 3' ITR sequence compared to the depositor's reference sequence. These differences do not affect plasmid function. These Please visit https://www.biorxiv.org/content/10.1101/2020.07.15.204347v1 for bioRxiv preprint.