Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hSyn-somBiPOLES-mCerulean
(Plasmid #154945)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154945 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 4359
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    somBiPOLES
  • Species
    Synthetic
  • Insert Size (bp)
    3273
  • Promoter human synapsin
  • Tag / Fusion Protein
    • soma-targeting motif from Kv2.1 channel (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer TGTTGCTCCTTTTACGCTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2). Please note that the Addgene verified sequence identified differences in the 3' ITR sequence compared to the depositor's reference sequence. These differences do not affect plasmid function. These Please visit https://www.biorxiv.org/content/10.1101/2020.07.15.204347v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSyn-somBiPOLES-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 154945 ; http://n2t.net/addgene:154945 ; RRID:Addgene_154945)
  • For your References section:

    BiPOLES is an optogenetic tool developed for bidirectional dual-color control of neurons. Vierock J, Rodriguez-Rozada S, Dieter A, Pieper F, Sims R, Tenedini F, Bergs ACF, Bendifallah I, Zhou F, Zeitzschel N, Ahlbeck J, Augustin S, Sauter K, Papagiakoumou E, Gottschalk A, Soba P, Emiliani V, Engel AK, Hegemann P, Wiegert JS. Nat Commun. 2021 Jul 26;12(1):4527. doi: 10.1038/s41467-021-24759-5. 10.1038/s41467-021-24759-5 PubMed 34312384