pEM-OptiCas9
(Plasmid
#154927)
-
PurposeaTc inducible OptiCas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep15A
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOptiCas9
-
Insert Size (bp)4104
-
MutationR661A, K1003H
- Promoter pTet
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer caggtgaacagaagaaagcca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM-OptiCas9 was a gift from Michael Lynch (Addgene plasmid # 154927 ; http://n2t.net/addgene:154927 ; RRID:Addgene_154927) -
For your References section:
CRISPR-Cas "Non-Target" Sites Inhibit On-Target Cutting Rates. Moreb EA, Hutmacher M, Lynch MD. CRISPR J. 2020 Dec;3(6):550-561. doi: 10.1089/crispr.2020.0065. 10.1089/crispr.2020.0065 PubMed 33346713