pKDsgRNA-pgaC
(Plasmid
#154919)
-
PurposeaTc inducible gRNA targeting pgaC along with arabinose-inducible lambda red enzymes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKD46
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNA targeting pgaC
-
SpeciesE. coli
- Promoter pTet
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttctcagggcgttttatggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKDsgRNA-pgaC was a gift from Michael Lynch (Addgene plasmid # 154919 ; http://n2t.net/addgene:154919 ; RRID:Addgene_154919) -
For your References section:
CRISPR-Cas "Non-Target" Sites Inhibit On-Target Cutting Rates. Moreb EA, Hutmacher M, Lynch MD. CRISPR J. 2020 Dec;3(6):550-561. doi: 10.1089/crispr.2020.0065. 10.1089/crispr.2020.0065 PubMed 33346713