Skip to main content
Addgene

pCS2+-PIF6-EGFP
(Plasmid #154913)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154913 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS2+
  • Backbone manufacturer
    RZPD
  • Backbone size w/o insert (bp) 4095
  • Total vector size (bp) 5122
  • Vector type
    Mammalian Expression ; xenopus/avian/zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    phytochrome interacting factor 3-like 2
  • Alt name
    PIF6, PIL2
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1056
  • Mutation
    1-100 amino acids of Arabidopsis PIF6
  • GenBank ID
    825382
  • Entrez Gene
    PIL2 (a.k.a. AT3G62090, PHYTOCHROME-INTERACTING FACTOR 6, PIF6, phytochrome interacting factor 3-like 2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer SP6 Forward ATTTAGGTGACACTATAG
  • 3′ sequencing primer M13 Reverse GGAAACAGCTATGACCATG, T3 Forward AATTAACCCTCACTAAAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+-PIF6-EGFP was a gift from Clare Buckley & Jonathan Clarke (Addgene plasmid # 154913 ; http://n2t.net/addgene:154913 ; RRID:Addgene_154913)
  • For your References section:

    Reversible Optogenetic Control of Subcellular Protein Localization in a Live Vertebrate Embryo. Buckley CE, Moore RE, Reade A, Goldberg AR, Weiner OD, Clarke JD. Dev Cell. 2016 Jan 11;36(1):117-26. doi: 10.1016/j.devcel.2015.12.011. 10.1016/j.devcel.2015.12.011 PubMed 26766447