pFGAMS-mMaple3
(Plasmid #154912)

• Purpose: Expresses human PFAS-mMaple3 fusion in mammalian cells
• Depositing Lab: Stephen Benkovic
• Publication: Chan et al Proc Natl Acad Sci U S A. 2018 Dec 18;115(51):13009-13014. doi: 10.1073/pnas.1814042115. Epub 2018 Dec 3.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Total vector size (bp): 8810
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PFAS
• Alt name: FGAMS
• Species: H. sapiens (human)
• Insert Size (bp): 4887
• GenBank ID: NM_012393
• Entrez Gene: PFAS (a.k.a. FGAMS, FGAR-AT, FGARAT, GATD8, PURL)
• Promoter: CMV
• Tag / Fusion Protein:
  • mMaple3 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The mMaple3 gene originated with Xiaowei Zhuang at Harvard and cloned from Addgene plasmid 101151.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry