pCS2+-Y276H PHYB-CAAX
(Plasmid #154911)

• Purpose: 1-621 amino acids of Arabidopsis PHYB (as in construct Addgene ID 154910) with the CAAX membrane moiety tag. Tyrosine residue 276 of PHYB was mutated to Histidine.
• Depositing Labs: Clare Buckley, Jonathan Clarke
• Publication: Buckley et al Dev Cell. 2016 Jan 11;36(1):117-26. doi: 10.1016/j.devcel.2015.12.011.

Backbone

• Vector backbone: pCS2+
• Backbone manufacturer: RZPD
• Backbone size w/o insert (bp): 4095
• Total vector size (bp): 6074
• Vector type: Mammalian Expression ; xenopus/avian/zebrafish

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Phytochrome B
• Alt name: PHYB
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2676
• Mutation: 1-621 amino acids of Arabidopsis PHYB, Tyrosine residue 276 of PHYB was mutated to Histidine
• GenBank ID: 816394
• Entrez Gene: PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
• Promoter: CMV
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • CAAX membrane moiety (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: SP6 Forward ATTTAGGTGACACTATAG
• 3′ sequencing primer: M13 Reverse GGAAACAGCTATGACCATG, T3 Forward AATTAACCCTCACTAAAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry