pDEST-ERBB2-v2
(Plasmid #154895)

• Purpose: Expresses ERBB2 (a.k.a HER2) fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assays
• Depositing Lab: Johanna Ivaska
• Publication: Al-Akhrass et al Oncogene. 2021 Feb;40(7):1300-1317. doi: 10.1038/s41388-020-01604-5. Epub 2021 Jan 8.

Backbone

• Vector backbone: pDEST-ORF-V2
• Backbone manufacturer: Addgene, #73638
• Backbone size w/o insert (bp): 5211
• Total vector size (bp): 7321
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ERBB2
• Alt name: HER2
• Species: H. sapiens (human)
• Insert Size (bp): 3765
• Entrez Gene: ERBB2 (a.k.a. CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19, NEU, NGL, TKR1, VSCN2, c-ERB-2, c-ERB2, p185(erbB2))
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus fragment 2 (v2) (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pDEST-ERBB2-v2.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry