Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDEST-ERBB2-v2
(Plasmid #154895)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154895 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDEST-ORF-V2
  • Backbone manufacturer
    Addgene, #73638
  • Backbone size w/o insert (bp) 5211
  • Total vector size (bp) 7321
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ERBB2
  • Alt name
    HER2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3765
  • Entrez Gene
    ERBB2 (a.k.a. CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19, NEU, NGL, TKR1, VSCN2, c-ERB-2, c-ERB2, p185(erbB2))
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus fragment 2 (v2) (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-ERBB2-v2 was a gift from Johanna Ivaska (Addgene plasmid # 154895 ; http://n2t.net/addgene:154895 ; RRID:Addgene_154895)
  • For your References section:

    A feed-forward loop between SorLA and HER3 determines heregulin response and neratinib resistance. Al-Akhrass H, Conway JRW, Poulsen ASA, Paatero I, Kaivola J, Padzik A, Andersen OM, Ivaska J. Oncogene. 2021 Feb;40(7):1300-1317. doi: 10.1038/s41388-020-01604-5. Epub 2021 Jan 8. 10.1038/s41388-020-01604-5 PubMed 33420373