pDEST-SorLA-v1
(Plasmid #154892)

• Purpose: Expresses SorLA fused to Venus fragment 1 (v1) for use in bimolecular fluorescence complementation (BiFC) assays
• Depositing Lab: Johanna Ivaska
• Publication: Al-Akhrass et al Oncogene. 2021 Feb;40(7):1300-1317. doi: 10.1038/s41388-020-01604-5. Epub 2021 Jan 8.

Backbone

• Vector backbone: pDEST-ORF-v1
• Backbone manufacturer: Addgene, #73637
• Backbone size w/o insert (bp): 5439
• Total vector size (bp): 10414
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SORL1
• Alt name: SorLA
• Alt name: LR11
• Alt name: Sortilin-related receptor
• Species: H. sapiens (human)
• Insert Size (bp): 6642
• Entrez Gene: SORL1 (a.k.a. C11orf32, LR11, LRP9, SORLA, SorLA-1, gp250)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus fragment 1 (v1) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pDEST-SorLA-v1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry