Non-targeting CRISPRi plasmid
(Plasmid
#154891)
-
PurposeHuman non-targeting CRISPRi gRNA
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCROP-seq-opti
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNontargeting gRNA
-
gRNA/shRNA sequenceGGAGGCGAGGTAAGACGCGG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mitra Lab accession number: pRM1890
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Non-targeting CRISPRi plasmid was a gift from Joseph Dougherty & Rob Mitra (Addgene plasmid # 154891 ; http://n2t.net/addgene:154891 ; RRID:Addgene_154891) -
For your References section:
High-throughput single-cell functional elucidation of neurodevelopmental disease-associated genes reveals convergent mechanisms altering neuronal differentiation. Lalli MA, Avey D, Dougherty JD, Milbrandt J, Mitra RD. Genome Res. 2020 Sep;30(9):1317-1331. doi: 10.1101/gr.262295.120. Epub 2020 Sep 4. 10.1101/gr.262295.120 PubMed 32887689