Skip to main content
Addgene

Non-targeting CRISPRi plasmid
(Plasmid #154891)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154891 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CROP-seq-opti
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nontargeting gRNA
  • gRNA/shRNA sequence
    GGAGGCGAGGTAAGACGCGG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mitra Lab accession number: pRM1890

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Non-targeting CRISPRi plasmid was a gift from Joseph Dougherty & Rob Mitra (Addgene plasmid # 154891 ; http://n2t.net/addgene:154891 ; RRID:Addgene_154891)
  • For your References section:

    High-throughput single-cell functional elucidation of neurodevelopmental disease-associated genes reveals convergent mechanisms altering neuronal differentiation. Lalli MA, Avey D, Dougherty JD, Milbrandt J, Mitra RD. Genome Res. 2020 Sep;30(9):1317-1331. doi: 10.1101/gr.262295.120. Epub 2020 Sep 4. 10.1101/gr.262295.120 PubMed 32887689