Skip to main content
Addgene

BRD4 CRISPRi plasmid
(Plasmid #154890)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154890 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    sgOpti
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRD4-targeting gRNA
  • gRNA/shRNA sequence
    GCGGCTGCCGGCGGTGCCCG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mitra Lab accession number: pRM1889

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BRD4 CRISPRi plasmid was a gift from Joseph Dougherty & Rob Mitra (Addgene plasmid # 154890 ; http://n2t.net/addgene:154890 ; RRID:Addgene_154890)

  • For your References section:

    Self-Reporting Transposons Enable Simultaneous Readout of Gene Expression and Transcription Factor Binding in Single Cells. Moudgil A, Wilkinson MN, Chen X, He J, Cammack AJ, Vasek MJ, Lagunas T Jr, Qi Z, Lalli MA, Guo C, Morris SA, Dougherty JD, Mitra RD. Cell. 2020 Aug 20;182(4):992-1008.e21. doi: 10.1016/j.cell.2020.06.037. Epub 2020 Jul 24. 10.1016/j.cell.2020.06.037 PubMed 32710817
Related items:
Commonly requested with: