Skip to main content
Addgene

pAAV-hSyn-fDIO-HA-KORD-IRES-mCitrine-WPREpA
(Plasmid #154871)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154871 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-hSyn-Flp-WPRE
  • Backbone manufacturer
    Gether lab - modified from Addgene plasmid #55641
  • Backbone size w/o insert (bp) 4828
  • Total vector size (bp) 7113
  • Vector type
    Mammalian Expression, AAV ; FLP-FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KORD-IRES-mCitrine
  • Insert Size (bp)
    2485
  • Promoter Human Synapsin-1
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site BamHi (not destroyed)
  • 5′ sequencing primer actcagcgctgcctcagtct
  • 3′ sequencing primer gatacaaaggcattaaagcagcg
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert is derived from Addgene plasmid #65417, whereas the backbone is derived from Addgene plasmid #55641 (wherein the Ef1a promoter is replaced with the human synapsin-1 promoter).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-fDIO-HA-KORD-IRES-mCitrine-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 154871 ; http://n2t.net/addgene:154871 ; RRID:Addgene_154871)
Related items:
Commonly requested with: