pAAV-hSyn-fDIO-EYFP-WPRE
(Plasmid
#154870)
-
PurposeHuman synapsin-1 promoter; Flp-dependent EYFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerKarl Deisseroth; Addgene plasmid #55641
- Backbone size w/o insert (bp) 4824
- Total vector size (bp) 5544
-
Modifications to backboneReplacement of Ef1a promoter with human synapsin-1 promoter
-
Vector typeMammalian Expression, Mouse Targeting, AAV ; FLP-FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEYFP
-
Insert Size (bp)771
- Promoter Human synapsin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu1 (not destroyed)
- 3′ cloning site BamHi (not destroyed)
- 5′ sequencing primer actcagcgctgcctcagtct
- 3′ sequencing primer gatacaaaggcattaaagcagcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid is modified from Addgene plasmid #55641.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-fDIO-EYFP-WPRE was a gift from Ulrik Gether (Addgene plasmid # 154870 ; http://n2t.net/addgene:154870 ; RRID:Addgene_154870)