Skip to main content
Addgene

pAAV-hSyn-fDIO-EYFP-WPRE
(Plasmid #154870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Karl Deisseroth; Addgene plasmid #55641
  • Backbone size w/o insert (bp) 4824
  • Total vector size (bp) 5544
  • Modifications to backbone
    Replacement of Ef1a promoter with human synapsin-1 promoter
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV ; FLP-FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EYFP
  • Insert Size (bp)
    771
  • Promoter Human synapsin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlu1 (not destroyed)
  • 3′ cloning site BamHi (not destroyed)
  • 5′ sequencing primer actcagcgctgcctcagtct
  • 3′ sequencing primer gatacaaaggcattaaagcagcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid is modified from Addgene plasmid #55641.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-fDIO-EYFP-WPRE was a gift from Ulrik Gether (Addgene plasmid # 154870 ; http://n2t.net/addgene:154870 ; RRID:Addgene_154870)