pAAV-hSyn-fDIO-rM3D(Gs)-mCherry-WPREpA
(Plasmid #154869)

• Purpose: Human synapsin-1 promoter; Flp-dependent rM3D(Gs) DREADD-mCherry
• Depositing Lab: Ulrik Gether
• Publication: Unpublished (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-hSyn-Flp-WPRE
• Backbone manufacturer: Gether lab - modified from Addgene plasmid #55641
• Backbone size w/o insert (bp): 4824
• Total vector size (bp): 6792
• Vector type: Mammalian Expression, AAV ; FLP-FRT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rM3D(Gs)-mCherry
• Alt name: Gs-DREADD
• Insert Size (bp): 1968
• Promoter: Human Synapsin-1
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc1 (not destroyed)
• 3′ cloning site: Nhe1 (not destroyed)
• 5′ sequencing primer: actcagcgctgcctcagtct
• 3′ sequencing primer: gatacaaaggcattaaagcagcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The insert is derived from Addgene #50458 and the backbone is modified (Ef1a promoter replaced with human synapsin promoter Addgene # Plasmid #55641).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry