Lenti-XYLT2-sgRNA
(Plasmid
#154862)
-
PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2 (addgene# 52961)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXYLT2 sgRNA
-
Alt nameXT2 sgRNA
-
gRNA/shRNA sequenceTGGTGGATGGCGGTTCTGAC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_022167
-
Entrez GeneXYLT2 (a.k.a. PXYLT2, SOS, XT-II, XT2, xylT-II)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- 3′ sequencing primer CACAGAGTTGGTGCCGATGGCCAGGCCGATGCTGTACTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-XYLT2-sgRNA was a gift from Yihong Ye (Addgene plasmid # 154862 ; http://n2t.net/addgene:154862 ; RRID:Addgene_154862) -
For your References section:
A myosin-7B-dependent endocytosis pathway mediates cellular entry of alpha-synuclein fibrils and polycation-bearing cargos. Zhang Q, Xu Y, Lee J, Jarnik M, Wu X, Bonifacino JS, Shen J, Ye Y. Proc Natl Acad Sci U S A. 2020 May 19;117(20):10865-10875. doi: 10.1073/pnas.1918617117. Epub 2020 May 4. 10.1073/pnas.1918617117 PubMed 32366666