Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-SLC35B2-sgRNA
(Plasmid #154860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154860 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2 (addgene# 52961)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC35B2 sgRNA
  • Alt name
    PAPST1 sgRNA
  • gRNA/shRNA sequence
    TCCGCCTGAAGTACTGCACC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_178148
  • Entrez Gene
    SLC35B2 (a.k.a. HLD26, PAPST1, SLL, UGTrel4)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • 3′ sequencing primer CACAGAGTTGGTGCCGATGGCCAGGCCGATGCTGTACTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-SLC35B2-sgRNA was a gift from Yihong Ye (Addgene plasmid # 154860 ; http://n2t.net/addgene:154860 ; RRID:Addgene_154860)
  • For your References section:

    A myosin-7B-dependent endocytosis pathway mediates cellular entry of alpha-synuclein fibrils and polycation-bearing cargos. Zhang Q, Xu Y, Lee J, Jarnik M, Wu X, Bonifacino JS, Shen J, Ye Y. Proc Natl Acad Sci U S A. 2020 May 19;117(20):10865-10875. doi: 10.1073/pnas.1918617117. Epub 2020 May 4. 10.1073/pnas.1918617117 PubMed 32366666