Skip to main content
Addgene

pAAV.CMV.SV40.THBS1-HA.SV40(polyA)
(Plasmid #154850)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154850 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Modified pAAV-MCS
  • Backbone size w/o insert (bp) 3601
  • Total vector size (bp) 7150
  • Modifications to backbone
    Truncated CMV enhancer sequence; beta-Globine intron replaced with SV40 intron; hGH polyA signal replaced with SV40 polyA signal
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Thrombospondin-1
  • Alt name
    THBS1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3549
  • Entrez Gene
    Thbs1 (a.k.a. TSP-1, TSP1, Thbs-1, tbsp1)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCCCCCTGAACCTGAAAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV.CMV.SV40.THBS1-HA.SV40(polyA) was a gift from Kevin Park (Addgene plasmid # 154850 ; http://n2t.net/addgene:154850 ; RRID:Addgene_154850)

  • For your References section:

    Thrombospondin-1 Mediates Axon Regeneration in Retinal Ganglion Cells. Bray ER, Yungher BJ, Levay K, Ribeiro M, Dvoryanchikov G, Ayupe AC, Thakor K, Marks V, Randolph M, Danzi MC, Schmidt TM, Chaudhari N, Lemmon VP, Hattar S, Park KK. Neuron. 2019 Aug 21;103(4):642-657.e7. doi: 10.1016/j.neuron.2019.05.044. Epub 2019 Jun 26. 10.1016/j.neuron.2019.05.044 PubMed 31255486
Related items:
Commonly requested with: