pASPIre1
(Plasmid
#154842)
-
PurposeDerivative of pSEVA291 carrying the bxb1 gene under the control of a rhamnose-inducible promoter and mCherry flanked by attB/P sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSEVA291
- Total vector size (bp) 7576
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsadd glucose to avoid premature recombination by Bxb1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBxb1 controlled by rhamnose-inducible promoter; attB/attP-flanked discriminator containing mCherry; rhaRS operon
-
SpeciesSynthetic
-
Insert Size (bp)4741
- Promoter Prha
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGGACCCCTGGATTCTCAC
- 3′ sequencing primer TACTCAGGAGAGCGTTCACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pASPIre1 was a gift from Markus Jeschek (Addgene plasmid # 154842 ; http://n2t.net/addgene:154842 ; RRID:Addgene_154842) -
For your References section:
Large-scale DNA-based phenotypic recording and deep learning enable highly accurate sequence-function mapping. Hollerer S, Papaxanthos L, Gumpinger AC, Fischer K, Beisel C, Borgwardt K, Benenson Y, Jeschek M. Nat Commun. 2020 Jul 15;11(1):3551. doi: 10.1038/s41467-020-17222-4. 10.1038/s41467-020-17222-4 PubMed 32669542