Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMS79 (eft-3p::Cas9 + sgRNA)
(Plasmid #154839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154839 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDD162
  • Backbone size w/o insert (bp) 8113
  • Total vector size (bp) 8132
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    GGACAGTCCTGCCGAGGTGG
  • Species
    Synthetic

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The vector backbone, pDD162, was received from Addgene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional protocol information can be found at: github.com/phillips-lab/SLP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMS79 (eft-3p::Cas9 + sgRNA) was a gift from Patrick Phillips (Addgene plasmid # 154839 ; http://n2t.net/addgene:154839 ; RRID:Addgene_154839)
  • For your References section:

    Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans. Stevenson ZC, Moerdyk-Schauwecker MJ, Jamison B, Phillips PC. G3 (Bethesda). 2020 Aug 19. pii: g3.120.401400. doi: 10.1534/g3.120.401400. 10.1534/g3.120.401400 PubMed 32816924