pMS79 (eft-3p::Cas9 + sgRNA)
(Plasmid
#154839)
-
PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDD162
- Backbone size w/o insert (bp) 8113
- Total vector size (bp) 8132
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceGGACAGTCCTGCCGAGGTGG
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer Tacaccttaaaggcgcacactc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe vector backbone, pDD162, was received from Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional protocol information can be found at: github.com/phillips-lab/SLP
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS79 (eft-3p::Cas9 + sgRNA) was a gift from Patrick Phillips (Addgene plasmid # 154839 ; http://n2t.net/addgene:154839 ; RRID:Addgene_154839) -
For your References section:
Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans. Stevenson ZC, Moerdyk-Schauwecker MJ, Jamison B, Phillips PC. G3 (Bethesda). 2020 Aug 19. pii: g3.120.401400. doi: 10.1534/g3.120.401400. 10.1534/g3.120.401400 PubMed 32816924