Skip to main content
Addgene

pQC-FsCFP-mCherryFP
(Plasmid #154836)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154836 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQC-XIG
  • Backbone size w/o insert (bp) 7116
  • Total vector size (bp) 7700
  • Modifications to backbone
    The nucleotide sequence consisting of Cerulan fluorescent protein (CFP), IRES and mCherryFP and flanked with NotI and EcoRV restriction sites was synthesized by using the service of Genscript, NJ
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    targeting sequence of VEGF
  • Alt name
    Vascular endothelial growth factor
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer AGAGCTCGTTTAGTGAACCGTC
  • 3′ sequencing primer TAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid contains "VEGF target sequence" cloned between Not1 and Xho1 restriction sites. People who receive this plasmid can simply digest the vector with Not1 and Xho1 to get rid of VEGF sequence and insert their target sequence for their gene of interest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQC-FsCFP-mCherryFP was a gift from Fangliang Zhang (Addgene plasmid # 154836 ; http://n2t.net/addgene:154836 ; RRID:Addgene_154836)
  • For your References section:

    Insertion/deletion-activated frame-shift fluorescence protein is a sensitive reporter for genomic DNA editing. Kumar A, Birnbaum MD, Moorthy BT, Singh J, Palovcak A, Patel DM, Zhang F. BMC Genomics. 2019 Jul 24;20(1):609. doi: 10.1186/s12864-019-5963-z. 10.1186/s12864-019-5963-z PubMed 31340764
Commonly requested with: