Skip to main content
Addgene

pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19)
(Plasmid #154824)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154824 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 4339
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Peft-3::wrmScarlet::tbb-2 UTR
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    1653
  • Promoter eef-1A.1 (eft-3)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCCCTCGATCTCGAACTC
  • 3′ sequencing primer gcatctgagtgaagtgaatgc
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    wrmScarlet coding sequence was amplified from pSEM89, a gift from Thomas Boulin (Mouridi S., C. Lecroisey, P. Tardy, M. Mercier, A. Leclercq-Blondel, et al., 2017 Reliable CRISPR/Cas9 Genome Engineering in Caenorhabditis elegans Using a Single Efficient sgRNA and an Easily Recognizable Phenotype. G3: Genes, Genomes, Genetics 7: 1429– 1437. https://doi.org/10.1534/g3.117.040824) Peft-3 and tbb-2 UTR was amplified from pDD162 which was received from Addgene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protocols, sequence information, and updates can be found at: https://github.com/phillips-lab/SLP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19) was a gift from Patrick Phillips (Addgene plasmid # 154824 ; http://n2t.net/addgene:154824 ; RRID:Addgene_154824)

  • For your References section:

    Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans. Stevenson ZC, Moerdyk-Schauwecker MJ, Jamison B, Phillips PC. G3 (Bethesda). 2020 Aug 19. pii: g3.120.401400. doi: 10.1534/g3.120.401400. 10.1534/g3.120.401400 PubMed 32816924
Related items:
Commonly requested with: