Skip to main content
Addgene

pLX301-ZIM3-KRAB-PYL1
(Plasmid #154761)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154761 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLX301
  • Backbone manufacturer
    David Root lab; Addgene plasmid #25895
  • Total vector size (bp) 8924
  • Modifications to backbone
    PYL1 inserted to the 3' end of the Gateway cassette
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow at 30 degrees to avoid recombination
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZIM3
  • Species
    H. sapiens (human)
  • Mutation
    Includes ZIM3 aa 1-100
  • Entrez Gene
    ZIM3 (a.k.a. ZNF264, ZNF657)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX301-ZIM3-KRAB-PYL1 was a gift from Mikko Taipale (Addgene plasmid # 154761 ; http://n2t.net/addgene:154761 ; RRID:Addgene_154761)

  • For your References section:

    An efficient KRAB domain for CRISPRi applications in human cells. Alerasool N, Segal D, Lee H, Taipale M. Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5. 10.1038/s41592-020-0966-x PubMed 33020655
Related items:
Commonly requested with: