XLone-Puro SARS-CoV2 N P2A eGFP-NLS
(Plasmid #154399)

• Purpose: PiggybacTransposon-based tunable and temporal expression control of SARS-CoV2 N and nuclear eGFP
• Depositing Lab: Xiaoping Bao
• Publication: Inducible COVID19 SARS-CoV2 Nucleocapsid Expressing Plasmid in Mammalian Cells (unpublished)

Backbone

• Vector backbone: XLone-BSD SARS-CoV2-N P2A mCherry Addgene #154398
• Backbone size w/o insert (bp): 5710
• Total vector size (bp): 7841
• Vector type: Mammalian Expression ; Piggybac
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV2 N Protein
• Alt name: Nucleocapsid
• Species: SARS-CoV2
• Insert Size (bp): 1275
• Entrez Gene: N (a.k.a. GU280_gp10)
• Promoter: TRE3G
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NheI or SpeI (not destroyed)
• 5′ sequencing primer: gcgcctataaaagagtgctga
• 3′ sequencing primer: M13 FWD

Resource Information

• A portion of this plasmid was derived from a plasmid made by: SARS-CoV-2-N was PCR amplified from Addgene plasmid #141391, gift from Dr. Nevan Krogan lab.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry