pNAD1
(Plasmid #154347)

• Purpose: pUC19 backbone with editing template for homologous recombination mediated deletion of Nitrate reductase gene of N. oceanica and selection based on zeocin resistance
• Depositing Lab: John van der Oost
• Publication: Naduthodi et al Biotechnol Biofuels. 2019 Mar 25;12:66. doi: 10.1186/s13068-019-1401-3. eCollection 2019.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 4789
• Total vector size (bp): 6952
• Modifications to backbone: The Zeocin resistance (ShBle) gene with the Violaxanthin Chlorophyll a Binding Protein Precursor (VCP) promoter and the terminators of alpha tubulin gene and clp protease proteolytic subunit of Nannochloropsis was cloned onto the pUC19 backbone via Gibson assembly along with the homologous recombination flanks for deletion of Nitrate reductase gene.
• Vector type: Bacterial Expression ; microalgae
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ShBle
• Alt name: ZeoR
• Species: Streptoalloteichus hindustanus
• Insert Size (bp): 375
• Mutation: none
• GenBank ID: txid2017
• Promoter: Violaxanthin Chlorophyll a Binding Protein Precursor (VCP) promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGTGATGGCCGAGTTAAGG
• 3′ sequencing primer: AAGTCGTCCTCCACGAAGTC

Resource Information

• Supplemental Documents:
  • pNAD 1 RNP.gbk
• A portion of this plasmid was derived from a plasmid made by: ShBle was obtained from addgene #62863

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry