Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSUI-SynP-CAS1sg
(Plasmid #154341)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154341 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSUI-SynP-sfGFP
  • Total vector size (bp) 3578
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAS1 sgRNA
  • gRNA/shRNA sequence
    CGTTTAACCGGTCTTGAGCC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ACTCTGCGACATCGTATAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUI-SynP-CAS1sg was a gift from I-Son Ng (Addgene plasmid # 154341 ; http://n2t.net/addgene:154341 ; RRID:Addgene_154341)
  • For your References section:

    CRISPRi-mediated Programming Essential Gene can as a Direct Enzymatic Performance Evaluation & Determination (DEPEND) System. Tan SI, Yu PJ, Ng IS. Biotechnol Bioeng. 2020 May 27. doi: 10.1002/bit.27443. 10.1002/bit.27443 PubMed 32458463