Skip to main content
Addgene

pJW1788
(Plasmid #154317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154317 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDONR221
  • Backbone size w/o insert (bp) 2360
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    linker::TEV::BioTag::AID*::3xFLAG donor for CT slot in the SapTrap cloning system
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    400

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
  • 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1788 was a gift from Jordan Ward (Addgene plasmid # 154317 ; http://n2t.net/addgene:154317 ; RRID:Addgene_154317)
  • For your References section:

    An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson BR, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006. 10.1093/genetics/iyab006 PubMed 33677541