Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDYU1G/γ-tubulin-mEGFP
(Plasmid #154301)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154301 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDYU1G
  • Backbone manufacturer
    Tomo Kondo
  • Vector type
    Dictyostelium Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    γ-tubulin
  • Species
    Dictyostelium discoideum
  • GenBank ID
  • Promoter actin15
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGGAGATCTATGCCAAGAGAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDYU1G/γ-tubulin-mEGFP was a gift from Shigehiko Yumura (Addgene plasmid # 154301 ; http://n2t.net/addgene:154301 ; RRID:Addgene_154301)
  • For your References section:

    An improved molecular tool for screening bacterial colonies using GFP expression enhanced by a Dictyostelium sequence. Kondo T, Yumura S. Biotechniques. 2020 Feb;68(2):91-95. doi: 10.2144/btn-2019-0127. Epub 2019 Dec 11. 10.2144/btn-2019-0127 PubMed 31825246