pLenti PGK mKate2-OGT D554N (Puro)
(Plasmid #154292)

• Purpose: Lentiviral vector encoding full length mKate2-2xFLAG-OGT (full length human O-GlcNAc transferase, D554N variant, no Ser/Thr glycosylation)
• Depositing Lab: Suzanne Walker
• Publication: Levine et al Proc Natl Acad Sci U S A. 2021 Jan 26;118(4). pii: 2016778118. doi: 10.1073/pnas.2016778118.

Backbone

• Vector backbone: pLenti PGK Neo (DEST)
• Backbone manufacturer: Campeau et al.
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 11717
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: O-GlcNAc Transferase
• Alt name: OGT
• Species: H. sapiens (human)
• Insert Size (bp): 3599
• Mutation: D554N mutation (Ser/Thr glycosylation-incompetent)
• GenBank ID: NM_181673.3
• Entrez Gene: OGT (a.k.a. HINCUT-1, HRNT1, MRX106, O-GLCNAC, OGT1, XLID106)
• Promoter: PGK
• Tags / Fusion Proteins:
  • mKate2 (N terminal on insert)
  • 2x FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTGTTCCGCATTCTGCAAG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pLentiPGKPuro mKate2-ncOGT D554N.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2020.10.22.351288 for bioRxiv preprint.