Skip to main content
Addgene

pEF1α -NWM-Node 2
(Plasmid #154254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154254 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEF-GFP
  • Backbone manufacturer
    #11154
  • Backbone size w/o insert (bp) 4311
  • Total vector size (bp) 4829
  • Modifications to backbone
    deleted GFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    reconstructed Node 2 of New World monkey retroCHMP3
  • Insert Size (bp)
    518
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggaatttgccctttttgagtttgg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Diane Downhour, Nels Elde laboratory, University of Utah

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1α -NWM-Node 2 was a gift from Wesley Sundquist (Addgene plasmid # 154254 ; http://n2t.net/addgene:154254 ; RRID:Addgene_154254)
  • For your References section:

    Recurrent evolution of an inhibitor of ESCRT-dependent virus budding and LINE-1 retrotransposition in primates. Rheinemann L, Downhour DM, Davenport KA, McKeown AN, Sundquist WI, Elde NC. Curr Biol. 2022 Feb 25. pii: S0960-9822(22)00240-8. doi: 10.1016/j.cub.2022.02.018. 10.1016/j.cub.2022.02.018 PubMed 35245459