Skip to main content
Addgene

3XFLAG_ALDOA in pCW57_tTA_Blast
(Plasmid #154210)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154210 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCW57
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ALDOA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1095
  • Entrez Gene
    ALDOA (a.k.a. ALDA, GSD12, HEL-S-87p)
  • Promoter TRE repeats (dox off)
  • Tag / Fusion Protein
    • 3X FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGCAGAGCTCGTTTAGTGAACC
  • 3′ sequencing primer CGAACGGACGTGAAGAATGTGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NheI site, 5' to the FLAG tag, can be used to remove 3X flag tag and clone in a tagless cdna if desired.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3XFLAG_ALDOA in pCW57_tTA_Blast was a gift from David Sabatini (Addgene plasmid # 154210 ; http://n2t.net/addgene:154210 ; RRID:Addgene_154210)

  • For your References section:

    Dihydroxyacetone phosphate signals glucose availability to mTORC1. Orozco JM, Krawczyk PA, Scaria SM, Cangelosi AL, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nat Metab. 2020 Sep;2(9):893-901. doi: 10.1038/s42255-020-0250-5. Epub 2020 Jul 27. 10.1038/s42255-020-0250-5 PubMed 32719541
Related items:
Commonly requested with: