TPI in pCW57_tTA_Blast
(Plasmid #154209)

• Purpose: Dox-off lentivirus construct all-in-one vector, with Blast resistance, for expression of TPI
• Depositing Lab: David Sabatini
• Publication: Orozco et al Nat Metab. 2020 Sep;2(9):893-901. doi: 10.1038/s42255-020-0250-5. Epub 2020 Jul 27.

Backbone

• Vector backbone: pCW57
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TPI1
• Species: H. sapiens (human)
• Insert Size (bp): 750
• Entrez Gene: TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
• Promoter: TRE repeats (dox off)
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGCAGAGCTCGTTTAGTGAACC
• 3′ sequencing primer: CGAACGGACGTGAAGAATGTGC

Resource Information

• Supplemental Documents:
  • tpi_isoform2_pcw.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry