CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
(Plasmid
#154196)
-
PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepRRL
-
Vector typeMammalian Expression, Lentiviral ; CaTCH barcode activation
-
Selectable markersNeomycin (select with G418) ; Thy1.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA-BC1-A, sgRNA-BC1-C
-
gRNA/shRNA sequenceGCTGTGCTCGTTCCACACAC, GGGCGAGCGCGCGCAAATGG
-
SpeciesSynthetic
- Promoter hU6 and mU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJohannes Zuber at Institute of Molecular Pathology, Vienna
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C was a gift from Anna Obenauf (Addgene plasmid # 154196 ; http://n2t.net/addgene:154196 ; RRID:Addgene_154196) -
For your References section:
Isolating live cell clones from barcoded populations using CRISPRa-inducible reporters. Umkehrer C, Holstein F, Formenti L, Jude J, Froussios K, Neumann T, Cronin SM, Haas L, Lipp JJ, Burkard TR, Fellner M, Wiesner T, Zuber J, Obenauf AC. Nat Biotechnol. 2020 Jul 27. pii: 10.1038/s41587-020-0614-0. doi: 10.1038/s41587-020-0614-0. 10.1038/s41587-020-0614-0 PubMed 32719478
