pEF1α-mouse-full-length-CHMP3-HA
(Plasmid #154176)

• Purpose: expresses mouse CHMP3 in mammalian cells
• Depositing Lab: Wesley Sundquist
• Publication: Rheinemann et al Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008.

Backbone

• Vector backbone: pEF-GFP
• Backbone manufacturer: #11154
• Backbone size w/o insert (bp): 4311
• Total vector size (bp): 5013
• Modifications to backbone: deleted GFP
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CHMP3
• Species: M. musculus (mouse)
• Insert Size (bp): 702
• Entrez Gene: Chmp3 (a.k.a. 25.1, 4921505F14Rik, 9130011K15Rik, CGI-49, D6Ertd286e, NEDF, Vps24)
• Promoter: EF1alpha
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggaatttgccctttttgagtttgg

Resource Information

• Supplemental Documents:
  • pEF1α-mouse-full-length-CHMP3-HA.gbk
• A portion of this plasmid was derived from a plasmid made by: Diane Downhour, Nels Elde laboratory, University of Utah

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry