Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEF1α-squirrel-monkey-CHMP3(155)-HA
(Plasmid #154173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154173 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEF-GFP
  • Backbone manufacturer
    #11154
  • Backbone size w/o insert (bp) 4311
  • Total vector size (bp) 4806
  • Modifications to backbone
    deleted GFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHMP3(155)
  • Species
    S. sciureus (squirrel monkey)
  • Insert Size (bp)
    495
  • Mutation
    C-terminal truncation of CHMP3 at amino acid 155
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ggaatttgccctttttgagtttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1α-squirrel-monkey-CHMP3(155)-HA was a gift from Wesley Sundquist (Addgene plasmid # 154173 ; http://n2t.net/addgene:154173 ; RRID:Addgene_154173)
  • For your References section:

    RetroCHMP3 blocks budding of enveloped viruses without blocking cytokinesis. Rheinemann L, Downhour DM, Bredbenner K, Mercenne G, Davenport KA, Schmitt PT, Necessary CR, McCullough J, Schmitt AP, Simon SM, Sundquist WI, Elde NC. Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008. 10.1016/j.cell.2021.09.008 PubMed 34597582