Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEMHE-TNKS-2
(Plasmid #154149)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEMHE
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 3064
  • Total vector size (bp) 6601
  • Vector type
    in vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tankyrase 2
  • Alt name
    TANKS2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3537
  • GenBank ID
    NM_025235.4
  • Entrez Gene
    TNKS2 (a.k.a. ARTD6, PARP-5b, PARP-5c, PARP5B, PARP5C, TANK2, TNKL, pART6)
  • Promoter T7
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer GGCTTCCTCTAGATTATCCATCGACCATACCTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Cat##34691

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE-TNKS-2 was a gift from Carmen Williams (Addgene plasmid # 154149 ; http://n2t.net/addgene:154149 ; RRID:Addgene_154149)
  • For your References section:

    Developmentally Programmed Tankyrase Activity Upregulates beta-Catenin and Licenses Progression of Embryonic Genome Activation. Gambini A, Stein P, Savy V, Grow EJ, Papas BN, Zhang Y, Kenan AC, Padilla-Banks E, Cairns BR, Williams CJ. Dev Cell. 2020 Jun 8;53(5):545-560.e7. doi: 10.1016/j.devcel.2020.04.018. Epub 2020 May 21. 10.1016/j.devcel.2020.04.018 PubMed 32442396