pGEMHE-TNKS-2
(Plasmid
#154149)
-
PurposeFor making TNKS-2 RNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEMHE
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 3064
- Total vector size (bp) 6601
-
Vector typein vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTankyrase 2
-
Alt nameTANKS2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3537
-
GenBank IDNM_025235.4
-
Entrez GeneTNKS2 (a.k.a. ARTD6, PARP-5b, PARP-5c, PARP5B, PARP5C, TANK2, TNKL, pART6)
- Promoter T7
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer GGCTTCCTCTAGATTATCCATCGACCATACCTTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene Cat##34691
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-TNKS-2 was a gift from Carmen Williams (Addgene plasmid # 154149 ; http://n2t.net/addgene:154149 ; RRID:Addgene_154149) -
For your References section:
Developmentally Programmed Tankyrase Activity Upregulates beta-Catenin and Licenses Progression of Embryonic Genome Activation. Gambini A, Stein P, Savy V, Grow EJ, Papas BN, Zhang Y, Kenan AC, Padilla-Banks E, Cairns BR, Williams CJ. Dev Cell. 2020 Jun 8;53(5):545-560.e7. doi: 10.1016/j.devcel.2020.04.018. Epub 2020 May 21. 10.1016/j.devcel.2020.04.018 PubMed 32442396