Skip to main content
Addgene

pCMV-dLbCpf1-BE-YE2
(Plasmid #154146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154146 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 8166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dLbCpf1-BE-YE2 (dCas12a-BE-YE2)
  • Alt name
    NLS-APOBEC1(W90Y+R132E)-dLbCpf1(D832A+E925A+D1148A)-NLS-UGI-NLS
  • Species
    Synthetic; Cpf1(Cas12a) is from Lachnospiraceae bacterium; APOBEC1 is from Rattus norvegicus
  • Insert Size (bp)
    4764
  • Mutation
    APOBEC1(W90Y+R132E), dLbCpf1(D832A+E925A+D1148A)
  • Promoter CMV
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)
    • SV40 NLS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-F(CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer BGH-R(TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pCMV-dLbCpf1-BE (addgene, #107685) was modified to incorporate combinations of mutations in the APOBEC1 domain.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-dLbCpf1-BE-YE2 was a gift from Jin-Soo Kim (Addgene plasmid # 154146 ; http://n2t.net/addgene:154146 ; RRID:Addgene_154146)
  • For your References section:

    Genome-wide specificity of dCpf1 cytidine base editors. Kim D, Lim K, Kim DE, Kim JS. Nat Commun. 2020 Aug 13;11(1):4072. doi: 10.1038/s41467-020-17889-9. 10.1038/s41467-020-17889-9 PubMed 32792663