Skip to main content
Addgene

scFv-GCN4-DNMT3a-DNMT3l
(Plasmid #154140)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154140 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AmpR-Ori
  • Backbone size w/o insert (bp) 2663
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    scFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3537
  • GenBank ID
    NM_007872.4 NM_019448.4
  • Promoter SFFV
  • Tags / Fusion Proteins
    • HA
    • sfGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGCGAGTCAGTGAGCGAG
  • 3′ sequencing primer CCCACTAGGTAATTGGCAGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    scFv-GCN4-DNMT3a-DNMT3l was a gift from Albert Jeltsch (Addgene plasmid # 154140 ; http://n2t.net/addgene:154140 ; RRID:Addgene_154140)
  • For your References section:

    Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101