Skip to main content
Addgene

Tn7 integration plasmid
(Plasmid #154134)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154134 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    R6K gamma pir + dependent origin of replication
  • Backbone size w/o insert (bp) 2996
  • Total vector size (bp) 4132
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin and Spectinomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir+
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    left and right end of Tn7 arm
  • Species
    Tn7
  • Insert Size (bp)
    444
  • Promoter no

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcttgcggccggccgc
  • 3′ sequencing primer ttgaagctagacaggcttatcttgg
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Spectinomycin resistant gene
  • Alt name
    spnR
  • Species
    Streptomyces spectabilis
  • Insert Size (bp)
    792
  • Promoter Spectinomycin resistance gene promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agtttggaactagatttcac
  • 3′ sequencing primer tcagtccagttatgctgtgaaaaagc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tn7 integration plasmid was a gift from Shimon Bershtein (Addgene plasmid # 154134 ; http://n2t.net/addgene:154134 ; RRID:Addgene_154134)

  • For your References section:

    Chromosomal barcoding of E. coli populations reveals lineage diversity dynamics at high resolution. Jasinska W, Manhart M, Lerner J, Gauthier L, Serohijos AWR, Bershtein S. Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z. 10.1038/s41559-020-1103-z PubMed 32094541
Related items:
Commonly requested with: