pRibo-Tt
(Plasmid #154124)

• Purpose: Expresses wt Ribo-T rRNA and a set of tRNAs in bacterial cells
• Depositing Lab: Alexander Mankin
• Publication: Aleksashin et al Nat Commun. 2020 Apr 20;11(1):1858. doi: 10.1038/s41467-020-15756-1.

Backbone

• Vector backbone: pAM552
• Backbone size w/o insert (bp): 1777
• Total vector size (bp): 8188
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): E. coli K12 POP2136
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: engineered bacterial rRNAs operon under control of pL promotor
• Species: Synthetic
• Insert Size (bp): 5525
• Promoter: pL

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtcaggggggcggagcctat
• 3′ sequencing primer: CAG CTC ATT TCA TCA ATA TTT TTT TGA TGG

Gene/Insert 2

• Gene/Insert name: bacterial tRNAs (Asp, Trp, Ile, Ala, Glu) operon under control of Ptac promoter
• Species: Synthetic
• Insert Size (bp): 669
• Promoter: Ptac

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcatcaaattaagcagaaggccat
• 3′ sequencing primer: AAT ACT CAT ACT CTT CCT TTT TCA ATA TTA

Resource Information

• Supplemental Documents:
  • pRibo-Tt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC identified a small discrepancy in the -10 region compared to the reference sequence. The depositor does not believe this to be of functional concern.