pSCIP-hCD69-TdTomato
(Plasmid #154095)

• Purpose: Self-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgene
• Depositing Lab: Scott McComb
• Publication: Bloemberg et al CRISPR J. 2021 Feb;4(1):104-119. doi: 10.1089/crispr.2020.0090.

Backbone

• Vector backbone: pQCi
• Backbone manufacturer: Derived from pX458 (Zhang lab)
• Backbone size w/o insert (bp): 9500
• Modifications to backbone: Modular BAIT site integrated (BsaI sites) Intron integrated into spCas9 sequence
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: GFP and tdTomato
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: [5HA]-P2A-tdTomato-[3HA]
• Alt name: 5' and 3' homology arms for insertion into human CD69 locus
• Alt name: P2A-TdTomato Fluorescent protein
• Species: Synthetic

Gene/Insert 2

• Gene/Insert name: hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG

Resource Information

• Supplemental Documents:
  • pSCIP-hCD69-tdTomato.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.03.25.008276v4 for bioRxiv preprint.